circad | circRNAs associated with diseases

hsa_circ_000984
Gene	CDK6	Organism	Human
Genome Locus	chr7:92462409-92463134:-	Build	hg19
Disease	Non-small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	31081091
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A total of 155 paired primary NSCLC tissues and corresponding non-tumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGCCTATGGGAAGGTGTTCA Reverse CCCCTCCTCCTCCTTTACGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, XY, Liu, YR, Zhou, JH, Li, W, Guo, HH, Ma, HP (2019). Enhanced expression of circular RNA hsa_circ_000984 promotes cells proliferation and metastasis in non-small cell lung cancer by modulating Wnt/β-catenin pathway. Eur Rev Med Pharmacol Sci, 23, 8:3366-3374.